Human HEK 293T cells were purchased from the German collection of micro-organisms and cell cultures (DSMZ) and authenticated using STR DNA typing. HEK 293T cells were cultured as described previously.12 The cell line was cultured for less than 6 months after receipt.

M1 macrophages were differentiated from freshly obtained PBMC using M1 macrophage Generation Medium DXF according to the manufacturer’s protocol (PromoCell GmbH, Heidelberg, Germany). In brief, freshly isolated PBMCs were seeded out in an appropriate amount of Monocyte Attachment Medium (C-28051, PromoCell GmbH) in a density of 1 million/cm² and incubated for 1–1.5 hours at 5% CO₂, 37°C. Subsequently, the non-adherent cells were removed by three washing steps with warm monocyte attachment medium, the M1 macrophage Generation Medium DXF (C-28055, PromoCell GmbH) was added to the remaining adherent monocytes and the cells were incubated with refreshment of the M1 macrophage Generation Medium DXF every 3 days for 9 days at 5% CO₂ and 37°C. At day 10, the differentiated M1-Macrophages were checked by flow cytometry for correct differentiation, transfected as described below and used for the mRNA microarrays and ELISAs.

For detection of mRNA expression changes in activated and miR-34a-5p transfected M1 macrophages the Agilent Low Input, one-color, Quick Amp Labeling Kit and SurePrint G3 Human Gene Expression 8×60Kv3 Microarray (Cat. No. G4851C, Agilent Technologies, Santa Clara, California, USA) was used corresponding to the manufacturer’s protocols. In brief, 100 ng total RNA was reversed transcribed at 40°C for 2 hours using T7 Primer. Subsequently, the cRNA was labeled with Cyanine3-pCp using the T7 RNA polymerase for 2 hours at 40°C. The purification of the labeled cDNA was performed with RNeasy Mini kit (Qiagen, Hilden, Germany) according to Agilent’s One-Color Gene Expression Microarray Protocol followed by the quantification using a NanoDrop2000 Spectrophotometer (Thermo Fisher Scientific, Waltham, Massachusetts, USA). The hybridization of 600 ng labeled cRNA to the microarray slide was carried out at 65°C, 17 hours, 10 rpm in the SureHyb chambers (Agilent Technologies). After two washing steps the microarray slide was scanned on the Agilent Microarray Scanner G2565BA (Agilent Technologies). The raw fluorescence signals were analyzed with the Agilent AGW Feature Extraction software (V.10.7.1.1, Agilent Technologies). Normalization of the background corrected values was done with the Biological Significance analysis using GeneSpring (V.14.9, Agilent Technologies). In our analysis only mRNAs with RefSeqAccession number were included that were detected in at least four of the tested samples. The fold change of the mRNAs from miR-34a-5p transfected M1-macrophages was calculated by normalization of the expression values to the mean expression values of the control samples.

The pSG5-mir-34a expression plasmid was synthesized and cloned by Eurofins Genomics and harbors the nucleotides 9151617-9151816 of chromosome 1 (Eurofins Genomics). The 3′UTRs of CXCR1, CXCR2, CXCR3, CXCL1, CXCL2, CXCL5, CXCL10, CXCL11, CXCL12, CXCL14, and CXCL16 were PCR amplified using specific primers and ligated via SpeI, SacI, or NaeI restriction sites into the pMIR-RNL-TK vector, which was described in Beitzinger et al.16 The target sites of positively tested target genes were mutated using specific primers by site-directed mutagenesis with the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies). The sequences of all specific cloning and mutagenesis primers are given in online supplemental tables 1 and 2.

The dual luciferase assays were performed as described previously.17 In brief, HEK 293T cells were seeded out and transfected after 24 hours with the respective combinations of reporter and expression vectors. PolyFect transfection reagent (Qiagen) was used for the transient transfections and the Dual-Luciferase Reporter Assay System Kit (Promega, Mannheim, Germany) for conducting the dual luciferase assays. All dual luciferase assays were conducted in duplicates and have been repeated four times.

CD4⁺ or CD8⁺ T cells were isolated, purity was confirmed, and the cells were cultured as described previously.15 17 The gating strategy for the CD4⁺ and CD8⁺ T cells is shown in online supplemental figure 1. CD4⁺ and CD8⁺ T cells were transfected with hsa-miR-34a-5p miScript miRNA Mimic (MIMAT0000255: 5′UGGCAGUGUCUUAGCUGGUUGU) or the allstars negative control (ANC) using HiPerFect transfection reagent (Qiagen) as mentioned earlier.15 Twenty-four hours post transfection CD4⁺ and CD8⁺ T cells were stimulated with PMA/Ionomycin (5 ng/500 ng) for 24 hours. After stimulation, 1×10⁵ of the transfected CD4⁺ and CD8⁺ T cells were stained with anti-CD4-FITC (RPA-T4, BD), anti-CD8-FITC (RPA-T8, BD) and anti-CXCR3-APC (1C6/CXCR3 (RUO), BD) or respective conjugated isotype control antibodies, fixed in 1% paraformaldehyde and analyzed by flow cytometry (FACS Canto II, BD Biosciences). The remaining transfected CD4⁺ and CD8⁺ T cells were used for western blot analysis, performed as described previously.15 CXCR3 was stained with a monoclonal rabbit anti human CXCR3 antibody (6H1L8, Thermo Fisher Scientific). α-tubulin served as loading control and was stained with a monoclonal rabbit anti human α-tubulin antibody (11H10, Cell Signaling Technology). The secondary antirabbit antibody was purchased from Sigma Aldrich (A0545, Sigma Aldrich).

1.5×10⁶ differentiated macrophages of two donors/mL/12well were transfected with 150 ng hsa-miScript miRNA Mimic miR-34a-5p (MIMAT0000255: 5′UGGCAGUGUCU UAGCUGGUUGU) or the ANC using HiPerFect transfection reagent (Qiagen). The transfections were carried out in three independent experiments from two donors. After 48 hours of transfection the M1 macrophages were activated using IFN-γ (50 ng/mL, Miltenyi Biotec) and LPS (10 ng/mL, Sigma Aldrich). Four hours after activation the supernatants of the transfected M1 macrophages were collected and CXCL10 as well as the CXCL11 secretion was quantified by the human CXCL10 or CXCL11 DuoSet ELISA Kit (R&D Systems) according to manufacturer’s protocol. The remaining M1 macrophages were stored in 700 µL Qiazol (Qiagen) at −80°C for subsequent RNA isolation.

After 48 hours following transfection, the M1 macrophages were activated using IFN-γ (50 ng/mL, Miltenyi Biotec) and LPS (10 ng/mL, Sigma Aldrich) for 20 hours. After stimulation, 1.5×10⁶ of the transfected M1 macrophages were used for western blot analysis, performed as described previously.15 CXCL10 was stained with a monoclonal rabbit anti human CXCL10 antibody (D5L5L, Cell Signaling Technology). CXCL11 was stained with a monoclonal mouse anti human CXCL11 antibody (10C6, Thermo Fisher Scientific). α-tubulin served as loading control and was stained with a monoclonal rabbit anti human α-tubulin antibody (11H10, Cell Signaling Technology). All secondary antibodies were purchased from Sigma Aldrich.

48 hours post transfection of ANC or miR-34a-5p into 1.5×10⁶ macrophages of two donors RNA isolation was conducted using the miRNeasy Mini Kit according to the manufacturer’s protocol (Qiagen). The levels of hsa-miR-34a-5p in the transfected M1 macrophages was determined by quantitative real time PCR (qRT-PCR) using the StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, USA) and the miScript PCR System (Qiagen) corresponding to the manufacturer’s protocols. In brief 200 ng total RNA was reverse transcribed into cDNA using the miScript RT II Kit with the miScript HiSpec Buffer (Qiagen). RNU6 served as endogenous control for miRNA expression. Ectopic expression of miR-34a-5p in M1 macrophages of the two donors is depicted in online supplemental figure 2.

Statistical analysis of the luciferase assays, the western blots, the FACS analysis and ELISA was performed with SigmaPlot 10 (Systat, Chicago, USA) applying Student’s t-test. Quantification of the western blots was carried out with Image Lab Software V.5.2.1 (Bio-Rad Laboratories, Hercules, California, USA). The asterisks in the figures correspond) to the statistical significance as calculated by Student’s t-test: *=0.01< p≤0.05; **=0.001<p≤0.01; ***=p≤0.001. For the pathway analysis of the deregulated mRNAs and predicted target genes by an over-representation analysis (ORA), we used GeneTrail3 using default settings (Null hypothesis (for p value computation): two-sided; method to adjust p values: Benjamini-Yekutieli; significance level: 0.05; reference set: all protein coding genes) (http://genetrail.bioinf.uni-sb.de/).18 For the protein–protein interaction network analysis we used the STRING database V.11 (https://string-db.org/) with default settings including the 20 most downregulated and upregulated mRNAs on miR-34a-5p over-expression to obtain a concise network.19 The in-silico target prediction was carried out using miRWalk 2.0 that uses 10 algorithms including DIANAmT3.0, miRanda (2010), miRDB (2009), miRWalk, RNAhybrid (V.2.1), PICTAR4 (2006), PICTAR5 (2007), PITA (2008), RNA22 (2008), and TargetScan5.1.20

In a former study we found miR-34a-5p over-expressed in CD56⁺ (natural killer cells), CD19⁺ (B cells), CD3⁺ (T cells) as well as CD14⁺ (monocytes) cells of patients with lung cancer.11 Subsequently, we identified miR-34a-5p as modulator of intracellular calcium signaling, NF-κB signaling in CD4⁺/CD8⁺ T cells and as major hub of T cell regulation networks.13 15 17 Here we set out to investigate the impact of miR-34a-5p over-expression on chemokine signaling by analyzing the mRNA expression changes in the M1 macrophages transfected with miR-34a-5p or ANC from two different donors of two independent transfection experiments (figure 1A). Out of 58 000 mRNAs contained in the Agilent microarray, 27 285 transcripts were detected in at least four out of the eight samples. In total, 480 protein-coding transcripts showed an at least 1.5-fold change in the miR-34a-5p transfected cells as compared with the control cells. Out of the 480 mRNAs, 184 were upregulated and 296 downregulated. An ORA of 480 deregulated mRNAs by GeneTrail3 identified 140 significant pathways in Gene Ontology (GO) category “biological process” and 12 significant pathways in the GO category “molecular function” for the downregulated mRNAs. Figure 1B,C displays a representative selection of the significant pathways of these two GO categories. For example, the five most significant pathways in the GO category “molecular function” were “cytokine activity” (p value ≤0.001), “cytokine receptor binding” (p value ≤0.001), “type I interferon receptor binding” (p value ≤0.001), “receptor ligand activity” (p value ≤0.001), and “signaling receptor activator activity” (p value ≤0.001). For the upregulated mRNAs only one significant pathway, GO molecular function: “nucleic acids binding” was detected. Online supplemental tables 3 and 4 summarize the complete results of the ORA analysis for the downregulated and upregulated mRNAs. To identify protein–protein interaction networks we conducted a protein–protein association analysis using the STRING database with the 20 most downregulated and upregulated mRNAs on miR-34a-5p over-expression applying an interaction score of ≥0.4. This analysis highlighted a central interaction network for the downregulated mRNAs consisting of IFNA16, IFNA4, IFNB1, INFL1, IL6, CXCL10, and CXCL11 (figure 1D). For the upregulated mRNAs no interaction network could be established (figure 1E).

To explore the function of miR-34a-5p in the regulation of the immune response via cytokines, we performed a combination of in-silico target prediction with downstream pathway analysis to identify potential miR-34a-5p target genes. First, we conducted an in-silico target prediction by miRWalk V.2.0. In total, we identified 57 373 potential target gene 3′UTRs of miR-34a-5p (figure 2A). We subsequently reduced the number of putative target genes to 12 802 by considering only target gene 3′UTRs, which were predicted by at least four different algorithms. To identify potential miR-34a-5p target genes related to chemokine signaling, we mapped the predicted target genes to the according pathways by GeneTrail3 and identified 655 significant pathways. Out of these pathways, 38 significant pathways belonged to GO Cellular Component, 16 to GO Molecular Function, 79 to Wiki Pathways, 146 to KEGG (Kyoto Encyclopedia of Genes and Genomes), and 375 to GO biological processes. The GO biological process category included the three significant pathways, “chemokine mediated signaling pathway” with 75 potential miR-34a-5p target genes, “positive regulation of chemotaxis” with 107 and “positive regulation of leukocyte migration” with 90 potential target genes. We subsequently deleted target genes, which have been validated by others according to miRTarBase21 and genes without canonical binding site for miR-34a-5p. Following these selection steps, we identified eight C-X-C motif ligands and three C-X-C motif receptors with miR-34a-5p binding sites in their 3′UTRs in the three pathways that is, “chemokine mediated signaling pathway,” “positive regulation of chemotaxis,” and “positive regulation of leukocyte migration.” The C-X-C motif ligands included CXCL1, CXCL2, CXCL5, CXCL10, CXCL11, CXCL12, CXCL14, CXCL16 and the C-X-C motif receptors included CXCR1, CXCR2, CXCR3.

Our in-silico target prediction identified eight C-X-C motif ligands and three C-X-C motif receptors with miR-34a-5p binding sites in their 3′UTRs including CXCL1, CXCL2, CXCL5, CXCL10, CXCL11, CXCL12, CXCL14, CXCL16 as well as CXCR1, CXCR2, CXCR3 (figure 3). We cloned the respective 3′UTR sequences into the pMIR-RNL-TK reporter vector and cotransfected these recombinants together with a miR-34a-5p expression vector in HEK 293T cells. Dual luciferase assays were conducted in duplicates and repeated four times. The luciferase activities (RLU (relative light units)) of the wild-type reporters were normalized against the RLU of the empty reporter vector. Among the C-X-C motif ligands, we found the strongest reduction of the RLU for CXCL11, which was reduced to 66.3% (p value ≤0.001). Except for the ligands CXCL2 and CXCL5, all other remaining C-X-C ligands were also significantly repressed by miR-34a-5p including CXCL14 (67.4%), CXCL1 (70.4%), CXCL10 (70.5%), CXCL16 (82.6%), and CXCL12 (83.3%) (figure 4A, left panel). Among the C-X-C motif receptors, we observed the strongest reduction of the RLU for CXCR3, which was reduced to 76.5% (p value ≤0.001). The remaining C-X-R receptors were also significantly repressed by miR-34a-5p including CXCR1 (86%) and CXCR2 (88.5%) (figure 4A, right panel). To validate the direct binding of miR-34a-5p to its target sites, we mutated the binding sites in the 3′UTRs of CXCL ligands CXCL1, CXCL10, CXCL11, CXCL14, CXCL16 and in the 3′UTRs of CXCR receptors CXCR1 and CXCR3. Except for CXCR1, all mutated reporter vectors showed a significant increase of the RLU when cotransfected with miR-34a-5p compared with the respective non-mutated recombinants indicating the direct binding of miR-34a-5p to its binding sites in the respective 3′UTRs (figure 4B).

To analyze the downstream effects of miR-34a-5p over-expression in immune cells, we focused on the CXCL10/CXCL1/CXCR3 axis, which is central for the development of an effective cancer control, the differentiation of naive T cells to T helper 1 (Th1) cells, and the direction of immune cells to their functional sites by a chemotactic gradient of the chemokines CXCL9, CXCL10, CXCL11 binding to CXCR3.22–24

We transfected CD4⁺ and CD8⁺ T cells with miR-34a-5p mimic or with “ANC” and activated the transfected T cells for 4 hours with PMA/Ionomycin 48 hours after transfection. Western blotting with an antibody directed against CXCR3 showed a reduction of endogenous CXCR3 protein to 67.4% in the miR-34a-5p transfected CD4⁺ T cells (p value ≤0.001) and to 33.2% in the miR-34a-5p transfected CD8⁺ T cells (0.01<p≤0.05) (figure 5A,B). Flow cytometry was used to analyze the effect of miR-34a-5p over-expression on CXCR3 cell surface expression. Following transfection and activation, we found a downregulation of CXCR3 cell surface expression to 56.4% in miR-34a-5p transfected CD4⁺ T cells (p value 0.001<p≤0.01) and to 2.5% in miR-34a-5p transfected CD8⁺ T cells compared with control transfected cells (p value ≤0.001) (figure 5C–G).

We next investigated the effect of miR-34a-5p on the CXCL10, CXCL11 secretion and the endogenous levels in M1-macrophages, which were recently identified to predominantly express CXCL10, and CXCL11 after immune checkpoint blockade.25 We differentiated monocytes in M1 macrophages, transfected the cells with miR-34a-5p mimics or with ANC, and activated the transfected cells with IFN-γ and LPS. Western blot analysis of three independent experiments from two different donors with antibodies against CXCL10 and CXCL11 showed a decrease of endogenous CXCL10 protein to 57.9% (p value ≤0.001) on miR-34a-5p over-expression and of endogenous CXCL11 protein to 52.6% (0.01<p≤0.05) (figure 6A,B). Using ELISA we found in three independent experiments from two different donors a reduced CXCL10 secretion to 69.3% (p value ≤0.001) and a reduced CXCL11 secretion to 59.2% (p value ≤0.001) in the supernatants of miR-34a-5p transfected M1 macrophages (figure 6C).