The 9464D cell line [obtained from Jon Wigginton, MD, while at the National Cancer Institute (NCI), Bethesda, MD] was derived from spontaneous neuroblastoma tumors arising in TH-MYCN transgenic mice on C57Bl/6 background developed originally by William A. Weiss, MD, PhD (University of California, San Francisco, CA) [24]. To create a high GD2-expressing 9464D cell line (9464D-GD2), as both GD2-synthase and GD3-synthase are required for GD2 presentation on the surface of cells, lentivirus for GD2-synthase and GD3-synthase (pLV-GD2-synthase-puromycin and pLV-GD3-synthase-blastocidin, designed in VectorBuilder) were sequentially transduced into 9464D cells. The 9464D cells were first transduced with GD2-synthase, and positively transduced cells were selected for using 6 μg/ml of puromycin; 9464D-GD2 synthase positive cells were then transduced with GD3-synthase, and positively transduced cells were selected for using 7.5 μg/ml of blasticidin. Stably transduced 9464D + GD2 + GD3+ cells (referred to as “9464D-GD2”) were then single-cell cloned. Two separate 9464D-GD2 clones were used for in vivo experiments.

The NXS2 cell line (kindly obtained from Ralph Reisfeld, PhD, The Scripps Research Institute, La Jolla, CA, and then maintained by Alice Yu, MD, University of California, San Diego, CA) is a moderately immunogenic, highly metastatic, GD2-positive murine neuroblastoma cell line [25]. NXS2 is a hybrid between GD2-negative C1300 (a neuroblastoma tumor that spontaneously arose in A/J mice [26]) and GD2-positive murine dorsal root ganglioma cells (C57Bl/6 J background, but does not express C57Bl/6 H-2 and therefore grows in immunocompetent A/J mice).

Cells were grown in DMEM medium supplemented with 10% FBS, 2 mM L-glutamine, and 100 U/ml penicillin/streptomycin at 37 °C in a humidified 5% CO2 atmosphere. 9464D-GD2 media was also supplemented with 5% M3 base as well as puromycin (6 μg/ml) and blasticidin (7.5 μg/ml) antibiotics to select for cells that retained the GD2 and GD3 synthase genes. GD2 expression and tumor cell viability (> 95%) were verified prior to tumor engraftment. Cells were routinely monitored for Mycoplasma by PCR testing as previously described [27].

External beam RT was delivered to in vivo tumors by an X-RAD 320 (Precision X-Ray, Inc., North Branford, CT) in one fraction to a maximum dose of 12 Gy on day 1 of treatment. Mice were immobilized using custom lead jigs that expose the tumor on the dorsal right flank and shield the rest of the mouse.

Hu14.18K322A, a humanized anti-GD2 mAb with a single point mutation K322A, was provided by Children’s GMP, LLC (St. Jude, Memphis, TN) [28]. Hu14.18-IL2 IC was provided by Apeiron Biologics (Vienna, AU) via the NCI (Bethesda, MD) and has been previously described [29]. Each 50 μg dose of IC contains 10 μg IL2 (corresponding to 150,000 IU based on the specific activity determined by the IL-2 sensitive CTLL-2 cell line) fused to 40 μg 14.18 anti-GD2 mAb (based on the molar amounts of IL2 and anti-GD2 mAb in the IC). A once daily IT dose of 50 μg in 0.1 mL IC was administered on days 6 through 10 for all in vivo NXS2 experiments and for 9464D-GD2 experiments when IC was combined with RT alone. For all other 9464D-GD2 experiments, the dose of IT-IC was halved to 25 μg per dose when combined with other immunotherapeutic agents due to concern for significant toxicities observed in preliminary experiments. For example, we observed 5/5 spontaneous deaths in one group by treatment day 9 when 12 Gy was combined with 50 μg IT-IC once daily starting on day 6, 200 μg anti-CTLA-4 on day 6, 50 μg CpG on days 6 and 8, and 500 μg anti-CD40 on day 3. Therefore, 50 μg IT-IC was administered for experiments in Figs. 2 and 3a as this was the standard dose used in previously published studies in combination with RT, while 25 μg IT-IC was administered for experiments in Figs. 3b, 4 and 5 as some mice were treated with IT-IC in combination with other immunotherapeutic agents.

Anti-mouse-CTLA-4 mAb (IgG2c isotype of the 9D9 clone) was provided by Bristol-Myers Squibb (Redwood City, CA) and functions similarly to the IgG2a isotype as previously described [30]. Anti-CTLA-4 mAb was administered intraperitoneally at a dose of 200 μg in 0.2 mL on days 6, 9, and 12. FGK 45.5 hybridoma cells producing the agonistic anti-CD40 antibody were a gift from Fritz Melchers, PhD (Basel Institute for Immunology, Basel, Switzerland). The mAb was obtained from ascites of nude mice injected with the hybridoma cells, and the ascites were then enriched for IgG by ammonium sulfate precipitation. Anti-CD40 mAb was administered at a dose of 500 μg in 0.2 mL intraperitoneally on day 3. CpG-1826 oligodeoxynucleotide (TCCATGACGTTCCTGACGTT) was purchased from TriLink Biotechnologies (San Diego, CA) or Integrated DNA Technologies (Coralville, IA) and administered at a dose of 50 μg in 0.1 mL IT on days 6, 8, and 10. Timing of treatments was selected based on prior studies [10, 12, 31, 32].

Female C57Bl/6 and A/J mice, ages 5 to 7 weeks old, were obtained from Taconic Farms (TAC, Germantown, NY) and from The Jackson Laboratory (JAX, Bar Harbor, ME). Mice were housed in the animal facilities at the Wisconsin Institutes for Medical Research and used in accordance with the Guide for Care and Use of Laboratory Animals. Intradermal tumors were established on the dorsal right flank of mice by injecting 2 × 10⁶ tumor cells in 0.1 mL of PBS using a 30G needle. Syngeneic A/J mice were injected with NXS2 cells and syngeneic C57Bl/6 mice were injected with 9464D-GD2 cells. Perpendicular diameters of the tumor were measured using calipers and tumor volume (mm³) was approximated as: (width² x length)/2.

For all in vivo experiments, mice were randomized immediately prior to start of treatment (designated as day 1) into each treatment group by ascending order of tumor size. Approximately half of naïve mice injected with tumor cells were randomized to achieve the needed number of mice with the stated average tumor size when starting treatment. In vivo experiments were performed at least in duplicate with five mice per treatment group, with reproducible results; representative data are shown, except when specifically stated otherwise.

For the NXS2 experiment depicted in Fig. 2, combined data from two replicate experiments are shown (n = 7 per treatment group in one experiment and n = 5 per treatment group in the second experiment, except for the IT-IC alone group which had four mice). Mice were untreated or treated with 12 Gy alone, IT-IC alone, or 12 Gy and IT-IC.

For the 9464D-GD2 experiment depicted in Fig. 3a, representative data from one experiment are shown for mice treated with 12 Gy alone or 12 Gy and 50 μg IT-IC. For Fig. 3b, mice were randomized to be untreated or treated with 12 Gy alone, anti-CTLA-4 alone, 12 Gy and IT-IC, 12 Gy and anti-CTLA-4, or 12 Gy, IT-IC and anti-CTLA-4. Control treatment groups receiving anti-CTLA-4 alone and RT with anti-CTLA-4 were only performed once, while trends for the remaining treatment groups were replicated in at least duplicate. The experiment in Additional file 1: Figure S1 was performed once with anti-CTLA-4 administered on days 6, 8, and 10, but similar results were previously obtained in the B78 melanoma model (not shown). For the experiments depicted in Fig. 4 and Additional file 2: Figure S2, mice were randomized to be untreated or treated with 12 Gy alone or 12 Gy, IT-IC, anti-CTLA-4, CpG, and anti-CD40.

Tumor-bearing A/J or C57Bl/6 mice rendered tumor-free by combined immunotherapy treatment were rechallenged on day 90 by injecting 2 × 10⁶ NXS2 cells or 1 × 10⁶ 9464D-GD2 cells in 0.1 mL PBS, respectively, into the opposite (left) flank. Aggregate data for 9464D-GD2 rechallenge experiments are shown for mice made tumor-free with aforementioned combinations, which in some mice also included an anti-TEM8 antibody, which is an anti-vascular antibody (kindly provided by Brad St. Croix, PhD, NCI, Bethesda, MD), which did not have a statistically significant effect on our tumor growth curves when combined with the treatment regimen used in these studies (data not shown) [33–36]. Naïve control mice were injected on the left flank with the same number of tumor cells. Mice were sacrificed when tumors exceeded 20 mm in any dimension or if mice demonstrated moribund behavior.

9464D-GD2 tumors were extracted on day 13 and incubated for 30 min at 37 °C in dissociation solution containing HBSS supplemented with 5% FBS, 1 mg/mL collagenase type D, and 100 μg/mL DNase I (Sigma-Aldrich) as previously described [12]. For cell surface staining, cells were incubated with anti-GD2-APC (clone 14G2a; BioLegend), anti-CD45-eF450 (clone 30-F11; eBioscience), anti-CD3-Alexa700 (clone 17A2; BioLegend), anti-CD4-PE-Dazzle594 (clone GK1.5; BioLegend), anti-CD8a-APC-eFluor780 (clone 53–6.7; eBioscience), anti-CD11b-BB700 (clone M1/70; BD Horizon), anti-Ly6G-BV711 (clone 1A8; BioLegend), anti-CD25-BB515 (clone PC61; BD Horizon), anti-FoxP3-PE-Cy7 (clone FJK-16 s; eBioscience), and Ghost Dye Violet 510 (Tonbo Biosciences). Flow cytometry data were acquired using an Attune NxT Flow Cytometer and analyzed using FlowJo version 10.1.

To visualize GD2 expression after tumor growth in vivo, immunohistochemistry (IHC) was performed as previously described [10, 11]. Untreated parental 9464D and 9464D-GD2 tumors were excised from 3 mice per group following 8–10 weeks of growth. Additionally, 9464D-GD2 tumors were also excised from 3 mice per group at baseline and 6 and 10 days after RT (12 Gy) to the tumor. Fresh tumor samples were cryo-embedded in OCT solution and sectioned. Frozen sections were fixed in − 20 °C acetone for 10 min and labeled overnight at 4 °C using a 1:200 dilution of anti-GD2-PE (clone 14G2a; BioLegend) and DAPI to stain the nucleus of live cells. Representative images were captured of each tumor specimen at 20x magnification using a Keyence BZ-X800 Fluorescence Microscope or Evos FL 2 Imaging System.

An in vitro ⁵¹chromium-release cytotoxicity assay was performed as previously described [10, 37]. Parental 9464D and 9464D-GD2 target cells were labeled with ⁵¹chromium and incubated for 4 h with or without hu14.18K322A and fresh peripheral blood mononuclear effector cells. ADCC was measured using a gamma counter (Packard Cobra II) to quantify release of ⁵¹chromium.

Whole exome sequencing (WES) on the murine models and FASTQ file preparation was performed using the Illumina NextSeq 500 High-Output Flow Cell (read length 2 × 150, 120 Gb, and 400 M reads) by the Sidney Kimmel Cancer Center Cancer Genomics Facility of Thomas Jefferson University (Philadelphia, PA).

The murine models’ WES paired-end FASTQ files were aligned to University of California Santa Cruz’s mouse reference genome mm10 with BWA-MEM (v0.7.17) [38]. Base quality scores were recalibrated using GATK (v4.0.3.0) [39]. Somatic mutations in 9464D and 9464D-GD2, and NXS2 with at least 50x coverage were called with MuTect2 [40] and filtered against A/J, C57BL/6 J, and C57BL/6 T as a panel of normal.

Tumor volume curves are displayed as means ± standard error of mean (SEM) until the first death occurred in the group, except for Fig. 3b where curves are displayed until the second death occurred in the group due to a single incidence of early death during treatment in the anti-CTLA-4 alone group. Tumor growth curves were analyzed using linear mixed-effects models including random intercepts for subjects followed by Tukey’s multiple comparisons adjustment. The tumor volumes were log transformed to account for the log-linear growth pattern. Survival curves were generated using the Kaplan-Meier method and pairwise comparisons were performed using proportional hazards model with a two-way factorial design. An unpaired Student t test on the log-transformed data was performed for the analysis in Fig. 4c. Wilcoxon two sample tests with Benjamini Hochberg adjustment was performed for the analysis in Fig. 5a and percentages are displayed as means ± SEM. All analyses were performed in R 3.5.0. P values less than 0.05 were considered significant and are indicated in figures as *** = P < 0.001; ** = P < 0.01; * = P < 0.05; NS = nonsignificant.

To simulate clinically high-risk neuroblastoma, we used the syngeneic NXS2 and 9464D murine models. NXS2 is a GD2-expressing hybridoma [41]. While 9464D has been reported to express GD2 in vitro [42], we did not observe expression of GD2 in the 9464D tumor cells by flow cytometry (Fig. 1a). Therefore, we transduced GD2 and GD3 synthase genes into 9464D (referred to as 9464D-GD2). 9464D-GD2 cells have a high level of GD2 expression (Fig. 1a), which was retained after at least 20 passages in vitro (data not shown). Furthermore, GD2 expression was retained in 9464D-GD2 tumors after growth in vivo (Fig. 1b) and was stable at 6 and 10 days after radiation compared to baseline (Fig. 1c). This GD2 expression on the 9464D tumor cells was sufficient to enable ADCC of the cells when incubated with an anti-GD2 mAb (Fig. 1d). As expected, we did not observe a difference in ADCC when the parental 9464D GD2-deficient cells were incubated with or without hu14.18K322A.Fig1Fig. 1

Retained GD2 expression in 9464D-GD2 after growth in vitro and in vivo and increased ADCC. a GD2 expression levels in 9464D parental and 9464D-GD2 cells growing in vitro were assessed by flow cytometry. Mean fluorescence intensity (MFI) of GD2 expression is shown for 9464D parental and 9464D-GD2 cells labeled with anti-GD2 mAb compared to the unstained controls. b After 8–10 weeks of growth in vivo, 9464D parental (top row) and 9464D-GD2 tumors (bottom row) were harvested and analyzed by IHC for GD2 expression (red, left panel). DAPI was used to stain the nuclei of cells (blue, middle panel), and the overlay of blue and red is in the right panel. c 9464D-GD2 tumors were harvested at baseline as well as 6 and 10 days after delivery of 12 Gy to the tumor and analyzed by IHC for GD2 expression. Sections were stained with DAPI alone (blue) anti-GD2-PE (red). d A chromium release assay was performed with different effector to target (E:T) ratios to compare cell-mediated cytotoxicity of parental 9464D and 9464D-GD2 cells incubated with or without hu14.18K322A. Percent lysis is shown for each E:T ratio (mean ± SEM)

To investigate whether an in situ vaccination response could be induced in syngeneic A/J mice bearing an NXS2 neuroblastoma (average tumor size 155 mm³ at the start of treatment), we measured tumor growth following treatment with 12 Gy alone, IT-IC alone, 12 Gy and IT-IC, or no treatment (Fig. 2). For those animals treated with RT and IT-IC, we observed complete tumor regression in 42% (5/12) of animals by day 30 (Fig. 2a), with 83% (10/12) surviving past 60 days and 75% (9/12) exhibiting disease-free survival past 60 days (Fig. 2b). For those animals treated with RT alone, 17% (2/12) had complete tumor regression by day 30 and 42% (5/12) survived past 60 days. For those animals treated with IT-IC alone, 27% (3/11) had complete tumor regression by day 30, but only one of these three had tumor-free survival past 60 days while one died spontaneously and one had tumor regrowth by day 46. None of the control untreated mice survived past 30 days (Fig. 2a). In summary, while there was no significant difference in tumor growth for those mice treated with RT alone versus IT-IC alone, mice that were treated with a combination of RT and IT-IC had a significant slowing of tumor growth and improved survival compared to all other groups, with the majority of mice remaining tumor-free past 90 days.Fig2Fig. 2

RT and IT-IC produced an in situ vaccination response in mice bearing NXS2 neuroblastoma. Intradermal NXS2 tumors (average starting size of 155 mm³ on day 15 post tumor cell implantation) were untreated or treated with IT-IC alone, 12 Gy alone, or 12 Gy and IT-IC. Tumor growth (a) and survival (b, p values are indicated in the table) curves are shown for each treatment group, with disease-free mice at day 60 denoted as complete responses (CR)

Our next step was to enhance the response of cold neuroblastoma tumors to immunotherapy. Based on previous observations in mice bearing advanced B78 melanoma [12], we hypothesized that a combination of innate and adaptive immunotherapeutic approaches would increase the antitumor efficacy against 9464D-GD2 neuroblastoma. Accordingly, in addition to RT, ½ dose IT-IC and anti-CTLA-4, we included treatment with CpG and anti-CD40. We observed significantly improved tumor control with this combined regimen, with 4 of 5 mice (80%) achieving complete tumor regression (Fig. 4a). By day 24, untreated control tumors were significantly larger in size, nodular and sometimes ulcerated, while tumors treated with combined innate and adaptive immunotherapy—that is, 12 Gy and combined ½ dose IT-IC, anti-CTLA-4, CpG, and anti-CD40—were significantly smaller and appeared mostly scarred by day 24 (Fig. 4b). Similar antitumor responses to those shown in Fig. 4a in mice bearing 9464D-GD2 tumors were also seen with RT combined with IT-IC, anti-CTLA-4, CpG, and anti-CD40 when we tested certain dose-related modifications, i.e., 50 μg IT-IC and 250 μg anti-CD40 compared to 25 μg IT-IC and 500 μg anti-CD40 (data not shown). In both the B78 melanoma model (data not shown) and the 9464D-GD2 model (Additional file 1: Figure S1), full combined treatment with RT, IT-IC, anti-CTLA-4, and anti-CD40/CpG was more effective than different double and triple combinations of these agents (with anti-CD40 and CpG being considered as one synergistic treatment activating innate immunity), where in both tumor models only full combined treatment resulted either in complete tumor regression in some mice or in the strongest tumor growth suppression.Fig4Fig. 4

A combined innate and adaptive immunotherapeutic approach leads to 9464D-GD2 tumor regression and immunological memory. a Tumor growth curves are shown for TAC mice bearing intradermal 9464D-GD2 tumors (about 50mm³) that were untreated or treated with RT alone or RT and combined ½ dose IT-IC, anti-CTLA-4 (CTLA), CpG and anti-CD40 (CD40). Tumor-free mice on day 60 are denoted as number of CR of total mice in the group. b) Photographs of 3 representative TAC mice per group taken on day 24 show contrasting tumor size and appearance after 12 Gy alone or 12 Gy and immunotherapy (ITx, or combined ½ dose IT-IC, anti-CTLA-4, CpG, and anti-CD40) compared to untreated control mice. c Mice previously bearing a 9464D-GD2 tumor on the right flank that had complete response to treatment were rechallenged on day 90 by injecting 9464D-GD2 cells into the left flank. Tumor volumes on day 30 after tumor cell injection are significantly larger for naïve mice compared to previously treated mice (p = 0.0003)

To determine whether a memory response was generated by the RT and combined ½ dose IT-IC, anti-CTLA-4, CpG, and anti-CD40 regimen, we rechallenged mice that achieved complete regression of their initial 9464D-GD2 tumor with the same tumor cells on the opposite flank on day 90 (Fig. 4c). Tumors engrafted in all naïve mice (19/19). Even though the majority of previously treated mice (15/17, or 88%) did not reject rechallenge, there was significant slowing of tumor growth in previously treated mice compared to naïve mice. The average tumor volume on day 30 after tumor cell injection (after which tumor engraftment becomes evident in naïve mice) in previously treated mice (15.4 mm³) was significantly smaller than that of naïve mice (51.5 mm³, p = 0.012), suggesting the presence of a memory response.

Analysis of cells in the 9464D-GD2 tumor microenvironment on treatment day 13 revealed an increase of CD4+ T cells, monocytes (Mono)/macrophages (Mac), CD8 to Treg ratio, and reduction of Tregs, whereas the percentages of NK cells and neutrophils were unchanged (Fig. 5). The significant reduction in Tregs seen here after treatment of 9464D-GD2 with RT combined with ½ dose IT-IC, anti-CTLA-4, CpG, and anti-CD40 was also seen after treatment of B78 melanoma with IT-IC, anti-CTLA-4, CpG, and anti-CD40 without radiation [12], suggesting that this immunotherapy plays a significant role in reducing Tregs in the tumor microenvironment.Fig5Fig. 5

Treated 9464D-GD2 tumors have significantly fewer T regulatory cells, with a higher CD8+ T cell to Treg ratio, and more CD4+ T cells and monocytes/macrophages compared to untreated tumors. Untreated 9464D-GD2 tumors and tumors treated with 12 Gy and combined ½ dose IT-IC, anti-CTLA-4 (CTLA), CpG, and anti-CD40 (CD40) were harvested on treatment day 13, and tumor microenvironment was analyzed by flow cytometry (a). Representative dot plots of Treg populations (defined as CD25 + FoxP3+ of CD45 + CD4+ live cells) are shown for three representative untreated (b) and treated (c) tumors (numerical values shown are the % of CD45 + CD4+ live cells that are Tregs)