A total of 254 women diagnosed with EOC who underwent staging or debulking surgery were enrolled. Cancerous tissue specimens were collected during surgery, frozen in liquid nitrogen, and stored at − 70 °C until analysis [19].

The clinical records of these patients were prospectively reviewed to obtain medical parameters such as age, operative findings, pathological findings, disease relapse, and prognosis. We defined disease characteristics according to the system of International Federation of Gynecology and Obstetrics [20]. Stage I and II diseases were considered early stage and stage III and IV as advanced. The maximal residual tumor size after each operation was recorded and divided into two groups, ≤1 cm and >  1 cm. Except for women with stage IA and grade I tumors, all patients received three to six courses of adjuvant platinum-based chemotherapy.

After completion of the primary treatment, regular follow-up was arranged every 3 months for 3 years, and every 6 months thereafter. Magnetic resonance imaging or computerized tomography was arranged for suspected disease relapse. Recurrence was considered when tumor marker (CA125) levels were ≥ 2 times the upper normal limit in two consecutive tests with 2-week intervals, findings of imaging studies and aspiration cytology were abnormal, or there was a biopsy-proven disease. The period of time from completion of the primary treatment until the date of confirmed relapse, progression, or last follow-up was calculated as disease-free survival (DFS). The time from diagnosis until the date of disease-related death or last visit was defined as OS [19].

Total RNA from ovarian cancer tissues was isolated for cDNA synthesis using TRIzol reagent (Invitrogen) following the manufacturer’s instructions. The samples were subsequently passed over a Qiagen RNeasy column (Qiagen) to remove small fragments. Then, total mRNA was reverse-transcribed to cDNA by a Moloney murine leukemia virus reverse transcriptase kit (Invitrogen).

BTLA is an immune-regulatory receptor and its ligand is the herpesvirus entry mediator (HVEM). BTLA (receptor)-HVEM (ligand) interaction could generate inhibitory effects on immune response to result in immune tolerance [21]. Thus, the roles of BTLA and HVEM on ovarian cancer patients were investigated by analyzing their expressions in the cancerous tissues.

To detect the RNA expression of BTLA and HVEM in the ovarian cancerous tissues, RT-PCR with primers specific for BTLA, HVEM, and GAPDH were applied for 30 cycles. The sequences of PCR primers were as follows: BTLA sense, 5′-GTCATACCGCTGTTCTGCAA − 3 and anti-sense, 5′-TTGAGTTCGGTCCAATGACA-3′; and HVEM sense, 5′-AGTGTCTGCAGTGCCAAATG-3′ and anti-sense, 5′-TCACCTTCTGCCTCCTGTCT-3′. The sense primer ACCCAGAAGACTGTGGATGG and anti-sense primer TGCTGTAGCCAAATTCGTTG were used to detect GAPDH. The amplification products were separated by 1% agarose gel electrophoresis and visualized after staining with ethidium bromide.

BTLA, HVEM, and β-actin RNA were reverse-transcribed to cDNA and then analyzed in a LightCycler Real-Time detection system (Roche Diagnostics): BTLA (Hs00699198_m1), HVEM (Hs00998604_m1), and β-actin (Hs03023880_g1) by TaqMan® gene expression assays. Relative expression levels were presented as the 2^−ΔΔCt method using β-actin as internal control [22]. The quantitative data were calculated with the numbers of cycles for amplification-generated fluorescence to reach a specific detection threshold (Ct value). In this study, a cycle number > 40 was defined as non-detectable. The expression levels of CTLA-4 (Hs00175480_m1), PD-1(Hs01550088_m1), and programmed death-ligand 1 (PD-L1) (Hs00204257_m1) were also analyzed.

Female C57BL/6 J mice age 6 to 8 weeks were purchased from National Taiwan University and bred in the animal facility of the National Taiwan University Hospital. All animal procedures were performed in accordance with approved protocols.

WF-3/Luc tumor cells for this ascitogenic animal model were generated from WF-3 tumor cells as described previously [23]. These cells were maintained in RPMI-1640, supplemented with 10% (volume/volume) fetal bovine serum, 50 U/mL penicillin/streptomycin, 2 mM L-glutamine, 1 mM sodium pyruvate, 2 mM non-essential amino acids, and 0.4 mg/mL G418 at 37 °C with 5% carbon dioxide.

In this animal model, two time points were indicated, day 14 (14 days after tumor challenge) as early disease and day 35 (35 days after tumor challenge) as advanced disease. Analysis of immune components at these two time points can display the alterations of host immunities in the tumor progression [24]. In addition, the tumor cells can intraperitoneally spread with ascites formation. Apart from tumor cells, different kinds of tumor-associated cells (TACs) including lymphocytes and regulatory elements such as cytokines could be detected from the tumor-related ascites. The malignant ascites could be regarded as part of the tumor microenvironment (TME) to reflect the association between host immunity and tumor cells in this TME [25, 26].

The therapeutic agents, including paclitaxel, cisplatin, bevacizumab, and olaparib (all from Sigma-Aldrich), diluted with DMSO, was intraperitoneally administered to mice. Anti-BTLA Ab (clone 6A6, Bio X cell) [28], anti-PD-1 Ab (clone RMP1–14, Bio X cell) [29], anti-PD-L1 Ab (clone 10F.9G2, Bio X cell) [30], anti-CD19 Ab (clone 1D3, Bio X cell) [31], LY294002 (Selleck Chemicals) [32], and BP-1-102 (Selleck Chemicals) [33] were also used for the following experiments.

Briefly, C57BL/6 J mice (10 mice per group) were intraperitoneally challenged with 1 × 10⁵ WF-3/Luc tumor cells on day 0. On day 3, paclitaxel (6 mg/kg, intraperitoneal use) and/or several agents, including anti-BTLA Ab (10 or 20 μg/mouse, intraperitoneal use), anti-PD-1 Ab (30 μg/mouse, intraperitoneal use), anti-PD-L1 Ab (30 μg/mouse, intraperitoneal use), anti-CD19 Ab (30 μg/mouse, intraperitoneal use), LY294002 (800 μg/mouse, intraperitoneal use), or BP-1-102 (40 μg/mouse, oral use), were administered daily until the day of euthanasia. In addition to paclitaxel, other therapeutic agents, including cisplatin (1 mg/kg, intraperitoneal use), bevacizumab (2 mg/kg, intraperitoneal use), or olaparib (5 mg/kg, intraperitoneal use) and/or anti-BTLA Ab (20 μg/mouse, intraperitoneal use) were daily applied to evaluate the anti-tumor effects since day 3. Mice were sacrificed on the indicated day for immunologic profiling assays, and the remaining animals (5 in each group) were kept until 100 days after tumor challenge or death for the OS analysis. Therapy was discontinued on day 100. Then, the surviving mice were subcutaneously re-challenged with 1 × 10⁵ WF-3/Luc tumor cells. Bioluminescence images of tumor growth were detected twice a week using an IVIS Imaging System Series 200 (Xenogen) [23].

Splenocytes of tumor-bearing mice treated with daily intraperitoneal paclitaxel 6 mg/kg for 14 days were harvested as described earlier. These splenocytes were first incubated in vitro with/without anti-BTLA Ab (10 or 20 μg/mL) for 1 h and then co-cultured with the irradiated WF-3/Luc tumor cells at various ratios (WF-3/Luc:splenocyte = 1:100, 1:50, 1:10, and WF-3/Luc only) in a 96-well plate (1 × 10⁴ cells/well) for 48 h. Irradiated WF-3/Luc tumor cells treated only with PBS or anti-BTLA Ab (10 or 20 μg/mL) were considered as control. The luciferase activities of tumor growth were measured using the IVIS Imaging System Series 200 (Xenogen), as described previously [23].

Direct ELISAs of murine interleukin (IL)-6, − 10, − 12, transforming growth factor-beta (TGF-β), Tumor necrosis factor-alpha (TNF-α), and interferon-gamma (IFN-γ) (e-Bioscience) in the supernatants of ascites were performed based on the manufacturer’s instructions [24].

Splenocytes were first obtained as described earlier and then stained with FITC-conjugated anti-mouse CD3 (Biolegend) and PE/Cy5.5-conjugated anti-mouse CD19 (Biolegend). The CD3⁻CD19⁺ cells (B lymphocytes) were sorted for further analysis on FACSAriaIII (BD Bioscience) by the Flow Cytometric Analyzing and Sorting Core Facility at National Taiwan University Hospital.

The B lymphocytes were first sorted as described. PBS, recombinant mouse IL-6 (20 ng/mL), IL-10 (20 ng/mL), or TGF-β (10 ng/mL) (PeproTech) was loaded with these collected B lymphocytes for 24 h. Then, the percentage of BTLA⁺CD19^hi B lymphocytes was analyzed by flow cytometry.

For the signal transduction pathways of IL-6 and IL-10 in B lymphocytes, western immunoblotting was performed [23]. Briefly, the sorted B cells (1 × 10⁶/well) were treated with serum-free media and seeded in a 24-well plate for 6 h. Then B cells were treated with PBS, IL-6 (10 and 20 ng/mL), and IL-10 (10 and 20 ng/mL) and harvested after 15 min of incubation. The protein extracts were quantified with a BCA Protein Assay Kit (Pierce). Then, 20 μg of each cell lysate was resolved by SDS/PAGE (10% gel), transferred onto a PVDF/nylon membrane (Millipore), and probed with Abs specific to phospho-STAT3, phospho-AKT, phospho-ERK, total STAT3, total AKT, total ERK, α-tubulin, and GAPDH (Genetex). The membrane was then probed with HRP-conjugated secondary Ab. The specific bands were visualized using an ECL® Western blotting system (GE Healthcare).

To analyze the efficiency of blockades of possible pathways in B lymphocytes, the anti-BTLA Ab (20 μg/mL), AKT (LY294002, 25 μM), STAT3 (BP-1-102, 2 μM), or ERK (PD98059, 10 μM) inhibitor was first incubated with sorted B cells for 1 h. Then, these cells were treated with PBS, IL-6 (20 ng/mL), IL-10 (20 ng/mL), or TGF-β (10 ng/mL) for the following 24 h. These B cells were analyzed to detect the phosphorylation status of STAT3, AKT, and ERK by western immunoblotting and to evaluate the percentages of BTLA⁺CD19^hi B lymphocytes by flow cytometry.

All statistical analyses were performed with SPSS for Windows version 15.0 (SPSS Inc., Chicago, IL). The clinicopathological characteristics between BTLA non-detectable and detectable groups were analyzed using the Chi-square test for dichotomized variables and the Mann-Whitney U test for continuous variables. Risk analysis of cancer recurrence and disease-related death was completed with the Cox regression model for hazard ratio (HR) and 95% confidence interval (CI). Spearman’s rank correlation was employed to evaluate the relationship between two immune checkpoints. The correlation coefficient, R value ≥0.4 was considered as correlated.

The in vivo and in vitro data were shown as mean ± SE (standard error), which represented at least two different experiments. The results of luminescence, ELISA, and flow cytometry were evaluated with the Kruskal-Wallis test. In the survival experiments, the event time distributions were analyzed by Kaplan-Meier method and log rank test. A p < 0.05 was defined as statistically significant.

Chemotherapy plays an important role on the treatment of EOCs. Integrating potential targets, including immune checkpoint blockades for enhancing the anti-tumor effects of chemotherapeutic agents is an emerging issue. Accordingly, to preclinically explore whether the combination of chemotherapy and BTLA inhibition has a synergistic impact on generating more potent anti-tumor effects, the mAb 6A6 was used for in vivo BTLA inhibition via variRous treatment protocols (Fig. 1a). The luciferase activities of WF-3/Luc tumors in mice with various regimens detected by the IVIS system are shown in Fig. 1b. The luciferase activities of mice treated with anti-BTLA Ab 10 μg/mouse (G3), or anti-BTLA Ab 20 μg/mouse (G4) alone were lower than those of PBS-treated group (G1) (p = 0.004, Kruskal-Wallis test) but similar to those of paclitaxel-treated group (G2) (p = 0.085, Kruskal-Wallis test) (Fig. 1c). Therefore, the anti-tumor effects of combination therapy with different mechanisms were further explored. The mice undergoing chemotherapy combined with anti-BTLA Ab 20 μg/mouse (G6: paclitaxel 6 mg/kg and anti-BTLA Ab 20 μg/mouse, 1.63 ± 0.04 × 10⁷) exhibited the least luminescence 35 days after tumor inoculation (G1: PBS-treated group, 1.04 ± 0.07 × 10⁸; G2: paclitaxel 6 mg/kg, 7.44 ± 0.25 × 10⁷; G3: anti-BTLA Ab 10 μg/mouse, 7.21 ± 0.18 × 10⁷; G4: anti-BTLA Ab 20 μg/mouse, 6.67 ± 0.17 × 10⁷; G5: paclitaxel 6 mg/kg and anti-BTLA Ab 10 μg/mouse, 2.82 ± 0.19 × 10⁷; p < 0.001, Kruskal-Wallis test, Fig. 1c).Fig1Fig. 1

Chemotherapy combined with anti-BTLA Ab significantly reduced peritoneal tumor volumes and extended survival of tumor-bearing mice. a Diagrammatic representation of different treatment protocols using paclitaxel and/or anti-BTLA Ab. Note: G1: PBS only; G2: paclitaxel 6 mg/kg; G3: anti-BTLA Ab 10 μg/mouse; G4: anti-BTLA Ab 20 μg/mouse; G5: paclitaxel 6 mg/kg and anti-BTLA Ab 10 μg/mouse; G6: paclitaxel 6 mg/kg and anti-BTLA Ab 20 μg/mouse. b Representative luminescence images of mice in various groups using the IVIS system on the indicated days after tumor challenge. (5 mice in each group) c Luminal analyses of tumor volumes in tumor-bearing mice with various regimens. Mice treated with paclitaxel and anti-BTLA Ab 20 μg/mouse exhibited the least luminescence (p < 0.001, Kruskal-Wallis test). (5 mice in each group). d Survival analysis of mice in the various groups. All mice treated with paclitaxel and anti-BTLA Ab 20 μg/mouse and 40% of mice treated with paclitaxel and anti-BTLA Ab 10 μg/mouse were alive 100 days after the WF-3/Luc tumor challenge. However, none of the mice in the other groups survived more than 70 days of tumor challenge (p < 0.001, log-rank test). (5 mice in each group)

We further evaluated if the immune profiles could correlate with the anti-tumor effects of mice treated with different strategies. The immunologic alternations including the activated T lymphocytes in splenocytes and TACs of ascites, in vitro tumor killing abilities of splenocytes and the expression levels of various pro- and anti-inflammatory cytokines in ascites were detected. CD223 was used as the activating marker of T lymphocytes [23, 24].

Compared with the other groups, the percentages of CD223⁺CD4⁺ (G6: 4.91 ± 0.08%; p = 0.001, Kruskal-Wallis test, Fig. 2a) and CD223⁺CD8⁺ T (G6: 3.61 ± 0.18%; p = 0.001, Kruskal-Wallis test, Fig. 2b) lymphocytes in splenocytes was highest in chemotherapy combined with anti-BTLA Ab 20 μg/mouse group. In addition, similar phenomena were identified in the TACs of ascites. The percentages of CD223⁺CD4⁺ (G6: 8.95 ± 0.18%; p = 0.001, Kruskal-Wallis test, Fig. 2c) and CD223⁺CD8⁺ (G6: 9.77 ± 0.15%; p = 0.001, Kruskal-Wallis test, Fig. 2d) T lymphocytes were also highest in chemotherapy combined with anti-BTLA Ab 20 μg/mouse group.Fig2Fig. 2

Immunologic alterations in tumor-bearing mice treated with chemotherapy and/or anti-BTLA Ab. a The percentages of CD223 expression of CD4⁺ T lymphocytes in splenocytes of various therapeutic groups. The percentage of CD223⁺CD4⁺ T lymphocytes in splenocytes was highest in paclitaxel combined with anti-BTLA Ab 20 μg/mouse group (p = 0.001, Kruskal-Wallis test). (5 mice in each group) b The percentages of CD223 expression of CD8⁺ T lymphocytes in splenocytes of various therapeutic groups. The percentage of CD223⁺CD8⁺ T lymphocytes in splenocytes was also highest with paclitaxel combined with anti-BTLA Ab 20 μg/mouse (p = 0.001, Kruskal-Wallis test). (5 mice in each group) c The percentages of CD223 expression of CD4⁺ T lymphocytes in TACs of ascites of various therapeutic groups. The percentage of CD223⁺CD4⁺ T lymphocytes in TACs of ascites was highest with paclitaxel and anti-BTLA Ab 20 μg/mouse (p = 0.001, Kruskal-Wallis test). (5 mice in each group) d The percentages of CD223 expression of CD8⁺ T lymphocytes in TACs of ascites of various therapeutic groups. The percentage of CD223⁺CD8⁺ T lymphocytes in TACs of ascites was also highest with paclitaxel combined with anti-BTLA Ab 20 μg/mouse (p = 0.001, Kruskal-Wallis test). (5 mice in each group) e Tumoricidal activity of splenocytes of tumor-bearing mice receiving chemotherapy treated with/without anti-BTLA Ab in vitro. e1 Representative luminescence figures of the in vitro tumor killing abilities of splenocytes by the IVIS system. (5 mice in each group) e2 Quantification of luminescence of in vitro tumor killing abilities of splenocytes by the IVIS system. Compared with the luminescence of WF-3/Luc cells co-cultured with splenocytes without anti-BTLA Ab, less luminal activity was detected in WF-3/Luc cells co-cultured with splenocytes receiving in vitro anti-BTLA Ab (p = 0.021 for WF-3/Luc:splenocyte = 1:100; p = 0.027 for WF-3/Luc:splenocyte = 1:50; and p = 0.039 for WF-3/Luc:splenocyte = 1:10, Kruskal-Wallis test). The splenocytes treated with anti-BTLA Ab could generate higher tumor killing activities than those without anti-BTLA Ab. (5 mice in each group) f Bar figures of concentrations of various cytokines in ascites of various groups. Note: F1: IL-12; F2: TNF-α; F3: IFN-γ; F4: IL-6; F5: IL-10; and F6: TGF-β. The pro-inflammatory cytokines such as IL-12 (p = 0.002), TNF-α (p = 0.002), and IFN-γ (p = 0.001) were highest with the chemotherapy combined with anti-BTLA Ab 20 μg/mouse. The concentrations of ant-inflammatory cytokines such as IL-6 (p = 0.83), IL-10 (p = 0.85), and TGF-β (p = 0.84) did not show differences among the various groups (all statistical analyses by Kruskal-Wallis test). (5 mice in each group)

To investigate the mechanism of regulating BTLA expression during tumor progression, the distribution of BTLA on immunocytes in mouse spleen was first analyzed by flow cytometry (Fig. 3a). As shown in Fig. 3a1-a3, BTLA can be expressed mostly on B lymphocytes rather than T lymphocytes and NK cells. When these B lymphocytes were further subclassified, BTLA was largely identified on the CD19^hi B lymphocytes (Fig. 3a4). Therefore, the BTLA⁺CD19^hi B lymphocytes were used to evaluate the regulation of BTLA expression.Fig3Fig. 3

IL-6 and IL-10 could induce more BTLA⁺CD19^hi B lymphocytes through the AKT and STAT3 signaling pathways. a Representative figures of flow cytometric analyses of the expression of BTLA on various kinds of immunocytes of splenocytes. Note: A1: T lymphocytes; A2: NK cells; A3: B lymphocytes; A4: subgroups of B lymphocytes (zone 1: BTLA⁻CD19^hi; zone 2: BTLA⁺CD19^hi; zone 3: BTLA⁺CD19^low(lo); zone 4: BTLA⁺CD19^lo). B lymphocytes, especially CD19^hi B lymphocytes, had higher percentages expressing the BTLA molecule. (5 mice in this analysis) b Kinetic alterations in BTLA⁺CD19^hi B lymphocytes in splenocytes of tumor-bearing mice after different days of tumor challenge. b1 Representative flow cytometric figures of percentages of BTLA⁺CD19^hi B lymphocytes in splenocytes on indicated days. (5 mice in each group) b2 Bar figures exhibited the percentages of BTLA⁺CD19^hi B lymphocytes in splenocytes on day 14 or day 35 after tumor challenge. The percentages of BTLA⁺CD19^hi B lymphocytes were higher on day 35 (17.74 ± 0.71%) than on day 14 (11.76 ± 0.52%) (p = 0.009, Kruskal-Wallis test). (5 mice in each group) c Kinetic alterations in BTLA⁺CD19^hi B lymphocytes in TACs of ascites from tumor-bearing mice after different days of tumor challenge. c1 Representative flow cytometric figures of BTLA⁺CD19^hi B lymphocytes in TACs at indicated intervals. (5 mice in each group) c2 Bar figures of the percentages of BTLA⁺CD19^hi B lymphocytes in TACs on day 14 or day 35 after tumor challenge. The percentages of BTLA⁺CD19^hi B lymphocytes were higher on day 35 (48.94 ± 0.92%) than on day 14 (19.34 ± 0.88%) (p = 0.007, Kruskal-Wallis test). (5 mice in each group) d Alterations in the percentages of BTLA⁺CD19^hi B lymphocytes in sorted B lymphocytes treated with IL-6, IL-10, or TGF-β, analyzed by flow cytometry. d1 Representative flow cytometric figures of the percentages of BTLA⁺CD19^hi B lymphocytes in sorted B cells. (5 mice in each group) d2 Bar figures of the percentages of BTLA⁺CD19^hi B lymphocytes in sorted B cells treated with respective cytokines. The percentages of BTLA⁺CD19^hi B lymphocytes increased under treatment with IL-6 or IL-10 compared with TGF-β (p = 0.033, Kruskal-Wallis test). (5 mice in each group) e Various signaling molecules of sorted B lymphocytes treated with IL-6 and IL-10, detected by western blotting and flow cytometric analyses. e1 IL-6 (10 or 20 ng/mL) could stimulate phosphorylation of STAT3 and AKT in sorted B lymphocytes. (5 mice in each group) e2 Phosphorylation of STAT3 and AKT in sorted B cells also could be promoted by IL-10 (10 or 20 ng/mL). (5 mice in each group) e3 The inhibition of p-AKT by LY294002 showed inhibition of p-STAT3 (Lanes 3 and 9). However, the inhibition of p-STAT3 by BP-1-102 did not block activation of p-AKT (Lanes 4 and 10). Therefore, AKT activation was upstream of STAT3 in the IL-6/IL-10 signaling pathway. (5 mice in each group) e4 Percentages of BTLA⁺CD19^hi B lymphocytes in sorted B lymphocytes pretreated with respective Ab or specific inhibitor and then incubated with respective cytokine, analyzed by flow cytometry. The percentages of BTLA⁺CD19^hi B lymphocytes decreased when the B lymphocytes were pretreated with anti-BTLA Ab, LY294002 (AKT inhibitor), or BP-1-102 (STAT3 inhibitor) compared with PD98059 (ERK inhibitor). (5 mice in each group) f Anti-tumor effects of chemotherapy combined with various BTLA-related inhibitors. (F1) Diagrammatic representation of different treatment protocols using paclitaxel and various BTLA inhibitors. Note: Ga: paclitaxel 6 mg/kg; Gb: paclitaxel 6 mg/kg and LY294002 800 μg/mouse; Gc: paclitaxel 6 mg/kg and BP-1-102 40 μg/mouse; Gd: paclitaxel 6 mg/kg and anti-BTLA Ab 20 μg/mouse. (F2) Representative luminescence images of mice in various groups using the IVIS system on day 35 after tumor challenge. (5 mice in each group) (F3) Luminal analyses of tumor volumes in tumor-bearing mice with various regimens. Mice treated with paclitaxel and various BTLA-related inhibitors exhibited less luminescence than the paclitaxel-treated group (p < 0.001, Kruskal-Wallis test). Among mice receiving paclitaxel and various BTLA-related inhibitors, those receiving paclitaxel and anti-BTLA Ab 20 μg/mouse showed the least luciferase activity (p = 0.002, Kruskal-Wallis test). (5 mice in each group) (F4) Survival analysis of mice in various groups. Animals treated with chemotherapy and respective BTLA-related inhibitor lived longer than those treated only with paclitaxel (p < 0.001, log-rank test). All mice treated with paclitaxel and anti-BTLA Ab 20 μg/mouse, 80% of mice treated with paclitaxel and BP-1-102 40 μg/mouse, and 40% of animals treated with paclitaxel and LY294002 800 μg/mouse were alive 100 days after WF-3/Luc tumor challenge. (5 mice in each group) g Schematic diagram showing possible regulation and preclinical application of BTLA